M. Heimann¹, P. Vandekerckhove², P. Ngendahayo¹ L. Janssens³.

¹ Institut de Pathologie et Genetique, Loverval, Belgium, Specialist Chirurgie Gezelschapsdieren, Wondelgem, Belgium and Dierkliniek ANUBIS, Aartselaar, Belgium

Never described in veterinary medicine, cap polyposis is here presented in a five year old Bearded Collie. Cap polyposis is a rare human benign colorectal disease described in 1985 by Williams et al. It has a distinctive clinicopathological feature.

The main clinical presentation is of rectal bleeding (80%) that can be associated to mucous diarrhoea (50%), chronic straining of stool and constipation, abdominal pain and tenesmus. Mucous diarrhoea can be severe enough to induce a protein loosing enteropathy. The clinical examination is often unremarkable. Polyps may be palpable on digital rectal examination. The commonest site of involvement is the lower rectum but it may involve also the sigmoid and the transverse colon.

At endoscopy, polyps appear red, covered by a cap of mucoid and fibrinopurulent exudate, sessile, and located at the apices of enlarged transverse mucosal folds covered by normal intervening mucosa.

The pathogenesis is not known. Abnormal colonic motility leading to mucosal prolapse may be an important cause. Helicobacter pylori have been associated in some cases but no other infectious agent. Tumour necrosis factor-alpha and inflammatory process may play a role.

The treatment of this condition remains empiric. Metronidazole and steroids have been effective in some cases. Infliximab, an antibody directed toward tumoral necrotic factor, in other. But in resistant cases polypectomy, recto sigmoid resection or panproctocolectomy may be required to control the diarrhoea. Rare cases of spontaneous resolution have been observed.

Cap polyposis is a treatable condition with good long-term prognosis and function in human. Patients with solitary cap polyp respond well to endoscopic polypectomy. However, patients with multiple polyps and concurrent anorectal pathology require surgical resection.

Our patient presented dyschezia, tenesmus, and mucoid faeces with blood traces. A rectal touch revealed a ring of polypoid masses at 5 cm from the anus. The faecal examination was unremarkable. Diet restriction, metronidazole and spasmolytiques had been administrated without improvement. A colostomy was performed. The histopathological examination of the surgical specimen revealed multifocal mucosal hyperplasia with micro-cysts and numerous polyps’ formation. The superficial portion of the polyps was often ulcerated and covered by a cap of fibrinopurulent exudate. Mucus hypersecretion and diffuse lymphoplasmocytic inflammation accompanied. A transient improvement followed the surgery but the patient died of unknown cause seven days after.

Harmoinen JA¹, Suchodolski JS², Ruaux CG ², Steiner JM ², Westermarck E¹, and Williams DA ¹. ¹Department of Clinical Veterinary Sciences, Helsinki University, Helsinki, Finland; ²Gastrointestinal Laboratory, Department of Small Animal Clinical Sciences, Texas A&M University, College Station, TX, USA

While the composition of the small intestinal microbiota is reported to have a significant impact on the health status of an animal, and food deprivation is a commonly recommended remedy in acute gastrointestinal disturbances in dogs, no data are available about the dynamics of the canine small intestinal microbiota during an unfed state. The aim of this study was to evaluate the dynamics of the jejunal microbiota before, during and after food deprivation.

Five healthy laboratory Beagle dogs with a permanent jejunal fistula located 60 cm distally from the pylorus were included into this study. Food was withheld for 5 days, but normal tap water was given ad libitum.  Jejunal juice samples were collected daily for 5 days via the fistula using a sterile cytology brush before, during and after food deprivation. Thorough clinical examination was performed and serum biochemistry and hematological values were evaluated daily during food deprivation. Bacterial DNA was purified, the variable V6-V8 region of 16S rDNA was amplified with universal bacterial primers, and PCR amplicons were subsequently separated by denaturing gradient gel electrophoresis (DGGE). Variation in the jejunal microbiota before, during and after food deprivation was evaluated by comparing similarity indices (Dice coefficient; 100% represents complete identity) of DGGE profiles using gel analysis software. Friedman two-way analysis of variance followed by multiple comparison test was used to test for the differences in the similarity percentages between the three phases.

No clinical, biochemical or hematological abnormalities were observed over the duration of the study. Mean (±SD) similarity indices of DGGE profiles before, during and after food deprivation were 76.9 (±3.1), 57.0 (±7.6), and 64.1 (±4.6), respectively. Food deprivation led to significant changes (p<0.05) in DGGE profiles when compared to profiles before the food deprivation period. However, the jejunal microbiota remained relatively stable during the food deprivation period, and significant daily changes were not observed. After food deprivation, jejunal microbiota returned close to the baseline determined before food deprivation.

This is the first study to show that there is a complex bacterial population in the canine jejunum during food deprivation. Also, the jejunal microbiota found after food deprivation differs significantly from the microbiota determined during periods of feeding. The fasted phase microbiota is hypothesized to be closely adhered to intestinal mucosa. More studies are warranted to determine the importance of these mucosa-associated bacteria (MAB) to the host.

P. Lecoindre¹, V. Gouni², M. Chevallier³. ¹Veterinary Clinic of Cerisioz, St Priest, ²Clinic of Small Animal Internal Medicine, National Veterinary School of Alfort, Maisons-Alfort, ³M. Mérieux Laboratory, Lyon, France.

Regional granulomatous enteritis is a rare form of canine inflammatory bowel disease characterized by transmural granulomatous inflammation that involves more frequently the distal ileum and ileo-colic junction and results in a stenosing, mass-like thickening of these regions of the intestine. Few cases are reported, whereas the etiology of this affection with guarded prognosis still remains unknown.

This short communication describes 8 cases of regional granulomatous enteritis in dogs and reports the results of long-term treatment.

Eight, small breed, adult dogs were referred to the Veterinary Clinic of Cerisioz for exploration of progressive, mostly small bowel diarrhea with weight loss. The clinical evaluation index was >9 for all the dogs (CIBDAI Score, Jergens 2003). Abdominal palpation to all dogs revealed a rigid, tubular mass in the cranial abdomen. Complete blood count revealed neutrophilia in 6 dogs.  Hypoproteinemia was observed in 5 cases. Fecal smears examinations and flotation were negative in all cases and stool cultures realized in 5 cases were normal. Abdominal ultrasonography confirmed an abnormal, segmental, parietal thickening of the distal ileum, with loss of layering, and hyperechogenicity of the peripheral fat, dilatation of the intestinal lamina proximally to this zone in 3 dogs, and an intestinal intussusception in 1 case. Mesenteric lymphadenopathy was observed in all dogs. Colonoscopy showed more or less severe inflammatory lesions localized to the ascendant colon. The ileo-colic junction was not passed through in 6 dogs because of severe inflammation. In 2 dogs partial thickness biopsies of the ileum were realized and histological examination revealed histiocytic infiltration.  Laparotomy was realized in the rest of the dogs and showed important thickening of the distal ileum associated with the presence of granulomas in 3 cases, extended inflammation to the caecum and the ileo-caecal junction in all cases, and mesenteric lymphadenopathy. All dogs presented a more or less pronounced stenosis, and enterectomy was realized. Histological examination of the intestine and the lymph nodes confirmed in all cases a transmural granulomatous inflammation. A medical treatment associating antibiotics (enrofloxacin and metronidazole), glucocorticoids and, in 3 cases, immunosuppressive drugs (ciclosporin, azathioprine) was initiated in all dogs. Long-term follow-up permitted to report the following results: among the 2 non-operated dogs one was stabilized after 2 years but is still under treatment, the other one was euthanized after an intestinal occlusion due to the disease diagnosed 1 month after initial diagnosis. Among the 6 operated dogs, 1 dog recovered completely 3 years after surgery, 3 are clinically stabilized but present episodic diarrhea necessitating medical treatment, 2 dogs were not improving for long time after surgery and were euthanized after 6 months because of persistent diarrhea.

B.Glanemann°, N.Bridger°, H.Schonenbrucher*, M. Buelte*, R.Neiger°

°Clinic for Small Animals and *Institute for Veterinary Food Science, Justus-Liebig University Giessen, Germany

Bacteria of the genus Mycobacterium are increasingly reported as pathogens that induce chronic infections in humans and dogs; however their importance in veterinary medicine seems currently underestimated. MAP is the causative agent of paratuberculosis, also known as Johne’s disease, a severe chronic incurable granulomatous bowel disease affecting domestic and wild animals. So far MAP infections have not been reliably detected in dogs. A re-emerging debate about the link between MAP and Crohn’s disease in humans is responsible for the increasing awareness of public health concerns about the occurrence of MAP infections in domestic animals. This study was designed to examine intestinal biopsies from dogs with a history of chronic gastrointestinal symptoms for the presence of MAP specific DNA by nested PCR (IS900), a semi-nested PCR (F57) and real time PCR (ISMav2, F57) and to determine whether the finding of MAP-DNA is associated with a specific histological result. The insertion sequence IS900 is a widely used MAP reference marker and the sequences F57 and ISMav2 have also been shown to be unique for MAP. Using two nested PCR systems and a real time PCR instead of conventional PCR guaranteed a very sensitive approach.

Clinical signs of the 42 dogs included in this study were: vomiting (n=24), small bowel diarrhoea (n=16), large bowel diarrhoea (n=11), haematochezia (n=6), melena (n=1) and haematemesis (n=1). Intestinal biopsies obtained by endoscopy were submitted for histopathological examination and molecular investigation.

Dogs had a mean age of 5.9 (SD±3.2) years, and 17 were male. Histopathological examination of the biopsy samples was indicative for IBD in 17 dogs and neoplasia in 6 dogs. Six dogs showed non-specific histo­pathological changes but did respond to dietary changes and were classified as food responsive enteropathy. In 13 cases histology revealed only mild non-specific changes secon­dary to a possible extra-gastrointestinal disorder (e.g. congestion) and a final diagnosis could not be established. MAP specific DNA was detected and confirmed by sequencing of the PCR amplicons in 8 (19%) dogs. The 8 dogs with positive MAP results were diagnosed with food responsive enteropathy (n=3), IBD (n=2) and no specific diagnosis (n=3).

Even though MAP DNA was not linked with a specific histological diagnosis, these results warrant further studies about the possible detection of viable MAP cells in canine intestinal biopsies by cultural investigation, especially in light of a possible zoonotic potential.

B. Glanemann, N. Hildebrandt, A.Moritz, R.Neiger

Small Animal Clinic, University of Giessen, Germany

Oesophagitis and benign oesophageal strictures occur secondary to oesophageal irritation and cause dysphagia and regurgitation. The most common causes of oesophagitis include gastric reflux under general anaesthesia, vomiting, foreign bodies and ingestion of caustic agents. Strictures usually result from granulation and scar tissue formation following ulceration caused by damage to the oesophageal mucosa. In cats, oesophageal strictures have also been reported as a complication of doxycycline and clindamycin therapy. The most commonly used therapy for oesophageal strictures in veterinary medicine is balloon dilation. Though balloon dilatation in single stricture is successful in up to 80% of patients, re-formation of stricture is a complication which can occur also after several consecutive balloon dilatations. In such cases PEG-tube feeding would be the recommended long-term management, although this is often declined by the owner due to the extensive maintenance requirement.

A 1 year old, female spayed domestic shorthair cat was presented with a 4 week history of dysphagia and regurgitation soon after oral treatment with clindamycin. Fluoroscopic and endoscopic examination confirmed the presence of a single cervical oesophageal stricture (initial diameter 1 mm), 4 cm caudal to the pharynx. Fluoroscopically and endoscopically guided balloon dilation was performed 4 times consecutively over a period of 3 weeks since re-formation of the stricture appeared within 3 to 7 days. Feeding via PEG-tube as long-term management of the condition was declined by the owner. A self-expanding metal esophageal stent (Boston Scientific, formally Schneider, Switzerland)  with the following dimension was subsequently implanted: fully open diameter 16 mm, length 30 mm. Prior to stent placement the stricture was dilated using balloons of 6- and 10 mm inflated diameter. The stent was passed into the stricture under direct endoscope guidance and fluoroscopically controlled release. Management after stent implantation included feeding on mashed canned food for the first 10 days.  On re-examination 5 weeks later the cat showed no signs of dysphagia or regurgitation and was fed on normal canned diet. At this time fluoroscopy revealed no oesophageal motility cranial to the stent, but the oesophagus showed normal motility caudal to the stent. Endoscopy showed a complete overgrowing of the stent with mucosa. 4 months telephone follow-up revealed no further signs of dysphagia or regurgitation on commercial canned cat food.

Recurrent oesophageal strictures after balloon dilation in cats might be successfully treated with a self-expanding stent, however more cases need to undergo this treatment before clear guidelines can be given.

We examined agreement between 4 board-certified pathologists who independently evaluated endoscopic mucosal biopsies of canine and feline stomach and intestine using WSAVA Guidelines (J Comp Pathol 2008, 138:S1-43). Slides with 2,287 pieces of tissue from 85 dogs and 41 cats were obtained from 7 institutions. Pathologists scored 16 histological parameters as normal, mild, moderate or severe. Spearman rank correlation coefficient was used to determine pair-wise correlation between individual pathologists (ie, 6 comparisons for each histologic lesion). Correlation was consistently very weak (ie, < 0.40) for gastric neutrophils (0.06-0.31), duodenal neutrophils (-0.03-0.37) duodenal eosinophils (0.08-0.40), deep gastric injury (5 of 6 comparisons were -0.03-0.38) and duodenal fibrosis (0.11-0.32). Inconsistent correlations that were weak included gastric eosinophils (3 of 6 comparisons were 0.06-0.32) and gastric atrophy (2 of 6 comparisons were 0.18-0.28). All comparisons for gastric intraepithelial lymphocytes (0.44-0.66), gastric lamina proprial lymphocytes (0.48-0.66), gastric fibrosis (0.41-0.69), gastric follicular hyperplasia (0.44-0.61) and duodenal crypt lesions (0.51-0.73) were stronger. Duodenal intraepithelial lymphocytes, lamina proprial lymphocytes, dilated lacteals and blunt villi each had 1 of 6 comparisons < 0.40. However, if the pair-wise correlation between 2 specific pathologists was consistently eliminated, 24 of the 25 remaining comparisons of these duodenal tissues were 0.42-0.73. Additional work is necessary to accomplish consistency on select histologic lesions (neutrophils, eosinophils, duodenal fibrosis, gastric atrophy, deep gastric injury). We suspect variation in staining and tissue processing contributed to lack of agreement between pathologists on eosinophils and neutrophils.

Inflammatory Bowel Disease (IBD) in humans and animals is characterized by persistent or recurrent gastrointestinal signs and histologic evidence of intestinal inflammation. The breakdown of immunologic tolerance to luminal antigens (bacteria or dietary components) is thought to be critical, perhaps resulting from disruption of the mucosal barrier, dysregulation of the immune system, or disturbances in the intestinal microflora. T lymphocytes are considered to play an essential role in the pathogenesis of IBD. Therefore, it is important to know the distribution of these cells in the intestine of healthy dogs. The aim of this study was to define the distribution pattern of CD3+ T lymphocytes in the intestine of healthy adult dogs and to compare it to neonatal puppies.

Full thickness biopsies were obtained from 7 different localisations (stomach, descending and ascending duodenum, jejunum, ileum, ascending and descending colon) from 6 adult and 4 neonatal healthy beagles. The paraformaldehyde-fixed, paraffin embedded tissue was stained with a CD3 antibody known to recognize canine CD3+ lymphocytes. The positive cells were counted per area of 200,000 µm² in the designated 7 localisations and at 4 different sites per localisation (lamina epithelialis (LE) and lamina propria (LP) of villi and crypts, respectively).

The horizontal distribution in adult dogs showed a maximum of CD3+ T lymphocytes in the duodenum and jejunum, whereas a decline was seen towards the ileum and colon. In the stomach, there were almost no positive cells. The vertical distribution revealed an accumulation in the villi, but only few positive cells in the crypts. In the villi of the duodenum and jejunum, there were significantly more CD3+ T lymphocytes in the LP then in the LE. Compared to the adult dogs, the neonatal dogs showed a similar distribution pattern, but on average ten times less CD3+ T lymphocytes in the analogous localisations.

In conclusion, the highest accumulation of CD3+ T lymphocytes in adults as well as neonates was found in the villi of the duodenum and the jejunum. The horizontal and vertical distribution pattern of CD3+ T lymphocytes was similar in adult and neonatal dogs, whereas adults revealed significantly more positive cells than neonates. Whether this increase of CD3+ T lymphocytes from neonatal to adult dogs is a continuous event or occurs in the first few weeks of life is currently not known.

Parvovirus infection is a common cause of canine infectious enteritis. It is highly contagious. Therefore, rapid and reliable diagnosis via in-house tests is important in a clinical setting. Different rapid in-house tests are available but their reliability has not been evaluated so far. The aims of this study were to evaluate three different in-house tests and to determine sensitivity and specificity compared to electron microscopy (EM) and polymerase chain reaction (PCR).

Faeces was collected via rectal swabs for in-house testing, EM and PCR from 3 groups of dogs: group A) 50 dogs with acute haemorrhagic diarrhoea with or without leucopaenia and with an incomplete vaccination history, group B) 10 dogs with chronic diarrhoea and no suspicion of parvoviral infection and group C) 40 dogs with no history or clinical evidence of gastrointestinal illness that were presented for orthopaedic, neurological or oncological diseases. The in-house tests (IDEXX Snap Test Parvo; Megacore FASTest Strip Parvo; Selectavet Witness Parvo card) were performed as per manufacturers’ instructions. EM and PCR were performed as previously published.^a,b

In group A 32 of the 50 dogs had positive PCR results, 10 of which were also positive in EM. In group B only one dog was PCR positive, no dog EM positive. In group C 5 dogs had positive PCR results, no dog was EM positive. Sensitivity and specificity were calculated separately in comparison to EM and PCR for the Snap test, the FASTest and Witness card. Sensitivity in comparison to EM was 50%, 60% and 40%, respectively. Specificity in comparison to EM was 97.8%, 97.8% and 92.2%, respectively. In comparison to PCR, sensitivity was 18.4%, 15.8% and 26.3%, respectively. Specificity in comparison to PCR was 100%, 100% and 95.2%, respectively.

Whether the positive PCR results in healthy dogs are indeed a parvovirus infection or if this represents only intestinal passage remains unclear. This applies also to the dogs with haemorrhagic diarrhoea as only 27 of the 32 dogs with positive PCR were discharged with the diagnosis of parvovirosis based on laboratory analysis. In conclusion, specificity of all in-house tests used is good to excellent, regardless if compared to EM or PCR; in contrast, sensitivity is poor. Thus, faecal in-house tests for parvovirus antigen detection cannot be recommended to exclude parvoviral enteritis in dogs, but a positive test result is very likely to be reliably true positive and appropriate management (quarantine, therapy) is necessary.

It has been reported that Chinese Shar Peis (CSPs) have a high prevalence of cobalamin deficiency. Using a genome wide scan with the canine minimal screening set 2 (MSS 2) we have previously shown that cobalamin deficiency appears to be hereditary in CSPs and linked to chromosome 13. Microsatellite markers DTR13.6 (part of the MSS-2) and REN13N11 (an additional marker, not part of the MSS-2) showed significant linkage disequilibrium with serum cobalamin deficiency in CSPs. Thus, the goal of this study was to evaluate the only known gene located on chromosome 13 in the same area as these two microsatellite markers, MYC_CANFA, for any mutations in this breed.

The database of the canine Ensemble Genomic map was used to identify genes that are located in close proximity to those microsatellite markers on chromosome 13. Only the MYC_CANFA gene, at location 28,240,103-28,242,545, with a distance of approximately 0.06 Mb to the microsatellite marker DTR13.6 was identified. Primers for the MYC_CANFA gene were chosen to amplify exons I and II, respectively. Two primer pairs were used (Forward [F]: CCCGTAACTCAAGATCGCCC, TCCAGGACTGCATGTGGAGCGGCT; Reverse [R]: TCCAGACCTAACGTTTCCCTTCCT, AGCCGCTCCACATGCAGTCCTGGA, respectively) for sequencing of exon I, and one primer pair (F: TCATCTGGTCACTGGTGGCTTGAA; R: TTCCAGTTCCTCCCTC CAATAGGT) for sequencing of exon II. Additional primer pairs were designed to reach into the intron/exon boundary area of both borders of exon I (F: TACCCGCTCAATGACAGCAGCTCG; R: ATCCTCGC TGGGCGCCGGCGGCTG) and exon II (F: CGTGATCAGATCCCGGAGTTGGAA; R: TGGGTGGACACATGGCATCTC TTA), respectively. The identity of the product was verified by direct sequencing. The DNA sequencing results were compared between cobalamin-deficient CSPs, CSPs with normal serum cobalamin concentrations, and the published DNA sequences as part of the Ensemble Genomic map. Also, sequencing results were compared to the published cDNA sequence for this gene.

DNA samples from three CSPs with undetectable serum cobalamin concentrations and three CSPs with serum cobalamin concentrations within the reference range were used for sequencing. No difference in the entire DNA sequence of the MYC_CANFA gene was found between any of the dogs belonging to either of the two groups, the published canine sequence, or the cDNA sequence.

In conclusion, cobalamin deficiency in CSPs does not appear to be due to a mutation of the MYC_CANFA gene. Further investigations are necessary to find another genomic locus in proximity to microsatellite markers DTR13.6 and REN13N11 on canine chromosome 13 that shows mutations in CSPs with cobalamin deficiency.

Acute haemorrhagic diarrhoea (AHD) is a common syndrome in dogs. Besides aggressive fluid therapy, many clinicians consider the use of antibiotics an important part of the treatment mainly because of suspected bacterial translocation from the gastrointestinal tract into the systemic circulation although the true risk has never been established. Thus, aim of the study was to investigate the role of bacterial translocation in dogs with AHD.

Patients met the inclusion criteria, if they were presented with an acute onset of bloody diarrhoea (< 3 days). 65 dogs were prospectively included in the study. Of each patient, 2 separate blood cultures were taken from the jugular veins. Clinical parameters were documented, and CBC, biochemistry, and coagulation profiles were performed. As control group, blood cultures of 23 healthy dogs were taken. Culture results were compared between dogs with AHD and healthy controls. In addition, clinical and laboratory data were compared between blood culture-positive and blood culture-negative dogs with AHD.

There was no significant difference between the number of positive blood cultures in dogs with AHD (8/66) and in healthy controls (3/23). Bacteria cultured from dogs with AHD were Clostridium spp. (n = 4), and Streptococcus constellatus Enterobacter cloacae, Corynebacterium spp., and non-differentiated gram-positive anaerobic bacteria (each in 1 dog). Bacteria cultured from healthy dogs were Clostridium perfringens, Corynebacterium spp., and hemolysing E. coli (each in 1 dog). No difference could be found between culture-positive and culture-negative dogs with AHD concerning the clinical parameters including severity of disease, temperature, and heart rate. Comparison of the laboratory values revealed significantly higher total protein and albumin in the blood culture-positive group with AHD (p = 0.0016 and p = 0.0018, respectively), but no difference for any of the other parameters tested.

Bacteraemia can be a feature of dogs with AHD, but also commonly occurs in dogs without gastrointestinal disturbances. In dogs with AHD, a positive blood culture is not associated with severity of disease or signs of sepsis. Although the bacteria cultured can be considered typical intestinal organisms, bacteraemia seems to be transient and of minor clinical importance. Increased protein fractions might be due to higher grade of dehydration in bacteraemic animals.